X
تبلیغات
زيست شناسي قاين
همکاری سوال کرده اند که آیادرهنگام پیوند کلیه یا برداشتن کلیه غده فوق کلیه نیز برداشته میشودودراین صورت چه تغییری در میزان هورمونهای مترشحه داده می شود؟

پاسخ: اگر غده کلیه برداشته شود فرد ظرف چند روز به علت اتلاف سدیم بدن به دلیل نبود آلدوسترون می میرد.



تاريخ : دوشنبه سی ام آذر 1388 | 8:25 | نویسنده : محمدحسن كاهي |
تاريخ : دوشنبه سی ام آذر 1388 | 7:55 | نویسنده : محمدحسن كاهي |
تاريخ : دوشنبه سی ام آذر 1388 | 7:47 | نویسنده : محمدحسن كاهي |
تاريخ : دوشنبه دوم آذر 1388 | 8:27 | نویسنده : محمدحسن كاهي |
آيا مي دانيد.........؟                                                                                                  

 

قهوه مي تواند معالجه موثري براي آلزايمر باشد؟ دو مطا لعه جديد پيشنهاد مي كند كه قهوه مي تواند در بيماري مربوطه مانع از دست دادن حافظه شود يا اين جريان را معكوس كند. اين تحقيق مي گويد كافئين التهاب مغز را كاهش مي دهد و از توليد پروتئيني كه بنظر مي رسد در ايجا بيماري آ لزايمر نقش دارد مي كاهد. اين مطالعات در نشريه بيماري آ لزايمر چاپ شده است.

 

 

يك رژيم غذايي سرشار از چربيها مي تواند خطر سرطان پانكراس را افزايش دهد؟برطبق مطالعه اي كه درنشريه انستيتو جهاني سرطان به چاپ رسيده افرادي كه بيش از 36% چربيهاي مصرفي شان چربيهاي اشباع است شانس بيشتري براي ابتلا به اين بيماري دارند. خطر اين بيماري در افرادي كه بيشترين چربيهايشان را از گوشت بدست مي آورند تا 43% افزايش مي يابد.

 

 

جنگنده با سرطان؟سا لها پيش محققان نشان داده اند كه چاي سبز مي تواند براي شما مفيد باشد. اكنون دانشمندان كشف كرده اند كه تركيبات فعال موجود در چاي سبز ممكن است پيشرفت سرطان پروستات را كند نمايد. يك محقق مي گويد " چاي سبز مي تواند يك مورد مناسب براي اضافه شدن به درمانهاي سنتي مثل شيمي درماني يا پرتو درماني باشد."

 

 

موم مرطوب گوش مي تواند نشانه اي براي خطر سرطان سينه باشد؟ مطالعه اي كه در ژاپن انجام شد نشان داد كه پروتئيني كه بوسيله ژن ايجاد كننده سرطان پستان ساخته مي شود ممكن است باعث توليد موم چسبناك در گوش و بوي زياد زير بغل شود. پزشكان مي گويند اين يافته مي تواند پيش بيني خطر سرطان سينه را در بيماران آسانتر كند.

 

 

تهوع صبحگاهي مي تواند با هوش نوزادان در ارتباط باشد؟ برطبق مطالعه اي كه در بيمارستان كودكان در تورنتو صورت گرفته زناني كه در هفته هاي اول بارداري احساس تهوع دارند كودكان با هوشتري بدنيا مي آورند. حالت تهوع مي تواند نشانه اي براي وضعيت مناسب جنين در رحم باشد.اين مطالعه روي زناني كه در سالهاي 1998 تا 2003 باردار شده بودند انجام گرفت.

 

 

آسپرين ممكن است خطر خونريزي مغزي را افزايش دهد؟ بر طبق مطالعه اي كه در نترلند انجام گرفته خوردن آسپرين براي مقابله به سكته يا حمله هاي قلبي خطر خونريزيهاي ميكروسكوپي در مغز را افزايش مي دهد. اما در اين مطالعه بيماران هيچ علامتي دال بر اين خونريزيها نشان ندادند.

 

 

بچه هايي كه از پدران مسن تر بدنيا مي آيند بهره هوشي كمتري دارند؟ يك مطالعه جديد روي 33000 كودك امريكايي نشان مي دهد كه آنهايي كه پدران مسن تري داشته اند توانايي شناختي كمتري دارند. محققين همچنين دريافته اند برخلاف اين بچه هايي كه از مادران مسن تر بدنيا مي آيند در آ زمونهاي شناختي نمره بالاتري بدست مي آ ورند.

 

 

يك ژن مردانه ممكن است جنسيت فرزند را تعيين كند؟ طبق گزارش نيويورك تايمز يك دانشجوي پزشكي انگليسي تحقيقي روي تاريخچه فاميلي تقريبا 1000 خانواده امريكايي و اروپايي انجام داده است. كاري جلاتلي* نتيجه گرفته است كه ژني وجود دارد كه مشخص مي كند يك مرد پسران بيشتري خواهد داشت يا دختران بيشتري يا اينكه به تعداد مساوي داراي پسر و دختر خواهد شد.

                                                                                                                                                      

 

غذا خوردن با ديگران مي تواند باعث افزايش اشتها شود؟ بر طبق تحقيقي كه بوسيله دانشگاه مونترا ل صورت گرفته مردم بخصوص افراد پيري كه در بيمارستان بستري شده اند وقتيكه با يكديگر غذا مي خورند مي توانند بيشتر بخورند.اين مطالعه كه روي واحد امراض پيري در بيمارستانها متمركز شده بود نشان داد كه اگر افراد در موقع غذا خوردن ميانكنش هاي اجتماعي بيشتري داشته باشند بيشتر غذا مي خورند.اين يافته ها از اين جهت مهم بنظر مي رسند كه اغلب بيماران مسن وقتيكه در بيمارستان بستري مي شوند خوب غذا نمي خورند.

 

 

برطبق تحقيقات كارشناسان بين المللي سرطان تخت هاي برنزه كننده به كشندگي آ رسنيك هستند؟ تحقيقي كه در نشريه سرطان شناسي لانست** به چاپ رسيده عنوان مي كند خطر سرطان پوست در افرادي كه استفاده از تختهاي برنزه كننده را قبل ا ز 30 سالگي شروع مي كنند تا 75% افزايش مي يابد.

 

 

يكي از تركيبات موجود در بستني مي تواند به مقاومت زنان در برابر ويروسHIV  كمك كند؟ محققين مينه سوتا مي گويند تركيبي از گليسرول كه همچنين در مواد آ رايشي استفاده مي شود و در شير هم وجود دارد مي تواند از ميمونها در برابر آلوده شدن به فرم اوليه اي از اين ويروس محافظت كند. اين يافته مي تواند اين اميدواري را ايجاد كند كه ساخت ژلها يا كرمهايي از اين نوع كه بصورت واژينال قابل استفاده هستند مي تواند خطر آلودگي زنان به اين ويروس را كاهش دهد.

 

 

يك نوشيدني گرم مي تواند باعث خونگرمي تان شود؟ بر طبق يافته هاي دانشگاه يا ل** *كه در 23 اكتبر منتشرشد افراد وقتيكه يك استكان قهوه داغ را در دست دارند بخشندگي و التفات آ نها به ديگران بيشتر است و ديگران را بيشتر درك مي كنند. عكس اين حالت زماني بود كه يك نوشيدني سرد در دست داشتند.

 

 

افراد داراي موي تيره بيشتر مستعد سرطان پوست هستند؟ دانشمندان آمريكايي تشخيص دادند كه جهش در ژن MC1R كه باعث سرطان پوست مي شود در افراد داراي موي تيره دو برابر بيشتر است. ظاهرا چنين اثري در افراد بلوند و سرخ رو وجود ندارد.

             

*Corry Gellatly         

**Lancet Oncology                        

***Yale

 

:  منبعhttp://news.aol.com/health/article

 

ترجمه: صديقه ذبيح نژاد

 



تاريخ : دوشنبه دوم آذر 1388 | 8:24 | نویسنده : محمدحسن كاهي |

یافته های یک مطالعه جدید پیشنهاد می کند که رنگیزه های طبیعی که در گیاهان یافت می شوند باعث حفاظت مردان و زنان مسن در برابر پوکی استخوان می شود.محققینی که بوسیله سرویس تحقیقاتی کشاورزی (ARS) حمایت می شوند یافته هایشان را در نشریه امریکایی تغذیه کلینیکی بصورت online منتشر کردند.

 



ادامه مطلب
تاريخ : دوشنبه دوم آذر 1388 | 8:18 | نویسنده : محمدحسن كاهي |

مروري كوتاه بر عملكرد نيمكره هاي مغز

     مغز انسان شامل نرونهايي است كه تعداد آنها به دهها  ميليون مي رسد. اين نرونها در نواحي مجراي مغز كه هر يك كاركردي تخصصي يافته دارد, انباشته شده اند. مغز از قسمتهاي متعددي ساخته شده و هشياري , از ارتباطات بين قسمتهاي مختلف مغز حاصل مي شود . مخ بزرگترين بخش مغز است و حدود 7/8 وزن مغز را به خود اختصاص داده است. مخ شامل دو نيمكره مي باشد كه از نظر شكل شبيه به هم هستند. تا مدتها به نظر مي رسيد كه اين دو نيمكره از جهت سازماندهي و كاركرد يكسانند اما با مطالعاتي كه دانشمندان انجام داده اند به اين نتيجه رسيده اند كه هر نيمكره مغز ويژگي خاص خود را دارد.



ادامه مطلب
تاريخ : دوشنبه دوم آذر 1388 | 8:15 | نویسنده : محمدحسن كاهي |
تاريخ : سه شنبه بیست و ششم آبان 1388 | 8:41 | نویسنده : محمدحسن كاهي |
پاور پوینت های زیست شناسی را می توانید از لینک زیر دریافت کنید:

http://www.worldofteaching.com/biologypowerpoints.html



تاريخ : جمعه بیست و دوم آبان 1388 | 21:8 | نویسنده : محمدحسن كاهي |
تاريخ : جمعه بیست و دوم آبان 1388 | 19:35 | نویسنده : محمدحسن كاهي |
تاريخ : جمعه بیست و دوم آبان 1388 | 19:33 | نویسنده : محمدحسن كاهي |
تاريخ : جمعه بیست و دوم آبان 1388 | 19:32 | نویسنده : محمدحسن كاهي |
تاريخ : جمعه بیست و دوم آبان 1388 | 19:14 | نویسنده : محمدحسن كاهي |
تاريخ : جمعه بیست و دوم آبان 1388 | 18:46 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 19:18 | نویسنده : محمدحسن كاهي |
از لینک زیر میتوانید می توانید سوال و راهنمای تصحیح را دانلود کنید.

سوال امتحان نهایی زیست شناسی و آزمایشگاه2 در خردادماه 88 همراه با راهنمای تصحیح (555 کیلو بایت)



تاريخ : چهارشنبه سیزدهم آبان 1388 | 19:15 | نویسنده : محمدحسن كاهي |
از لينك زير مي توانيد سوالات را دانلود كنيد:

سوال زیست شناسی2 شهریور 88 همراه با راهنمای تصحیح(۳۰۵ کیلو بایت)



ادامه مطلب
تاريخ : چهارشنبه سیزدهم آبان 1388 | 19:14 | نویسنده : محمدحسن كاهي |
برای دریافت هر دفترچه ، روی عبارت مربوط به آن کلیک نمایید:

دفترچه اختصاصی تجربی شماره 1 آزمون سراسری سال 88
( زمین شناسی )

دفترچه اختصاصی تجربی شماره 2 آزمون سراسری  سال 88
( ریاضی + زیست شناسی + فیزیک+ شیمی )

پاسخ کلیدی ( اولیه ) تست های رشته تجربی -آزمون سراسری سال 88



تاريخ : چهارشنبه سیزدهم آبان 1388 | 19:4 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 18:50 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 18:19 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 18:17 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 18:5 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 18:0 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:58 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:55 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:42 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:39 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:35 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:33 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:28 | نویسنده : محمدحسن كاهي |

21-هردو زنجیره ی DNA ............

   1)ازنظرترکیب شیمیایی متفاوت اند.                                     2) رانمی توان ازهم جدا کرد. 

   3)ازنظر ترکیب شیمیایی مشابه اند.                                    4) باعوامل فسفات به هم وصل اند.

22-تعداد بازهای C دریک ملکول   mRNA باتعداد کدام برابر است؟

  1)U                      2) T                  3)G                       4) بدون دانستن محصول پروتئینی حاصله نمی توان پیش بینی کرد

23-کدام درباره ترجمه درست است؟

   1)اسیدآمینه ی جدید ابتدا به جایگاه A ریبوزوم وارد می شود.   2) درهر انتقال ، tRNA ازجایگاه p بهA منتقل می شود.

   3)tRNA حامل متیونین رها نمی شود.                                4) رمز دوم وارد جایگاه P نخواهد شد.

24-   درباکتری ها برای ساختن RNA پلیمراز ، ازکدام رونویسی می شود؟

   1)اپراتور                    2) راه انداز                     3) ژن ساختمانی                  4) ژن تنظیم کننده

25-تغییر در یک جفت نوکلئوتید ................... را جهش نقطه ای می نامند.

   1)مجاور دریک رمزژنتیکی    2)مجاوردریک زنجیره DNA   3) مکمل دارای پیوند هیدروژنی       4) متعلق به دورمز ژنتیکی کنار هم

26-درصورتی که جهش نقطه ای مضر دریکی از ژنهای اپران لک اتفاق بیفتد باروشن شدن اپران نهایتاٌ چند آنزیم باساختار مناسب ساخته می شود؟

   1)دوآنزیم                 2) سه آنزیم                      3) چهار آنزیم                     4) پنج آنزیم

27-منومرهای سازنده کدام یک ، اسید آمینه نیست؟

   1)عوامل رونویسی               2)RNA پلیمراز              3) مهارکننده لک                   4) عامل تنظیمی اپران لک

28- درنوروسپورا به ترتیب کدام آنزیم افزاینده وکدام رمز آغاز ترجمه را می سازد؟

  1)RNA پلیمرازII –RNA پلیمرازIII                          2) DNA پلیمراز –RNA پلیمرازIII                         

  3) RNA پلیمراز III  –DNA پلیمراز                       4)DNA پلیمراز –RNA پلیمرازII                         

29-کدام یک از موارد زیر در ساختار ریبوزوم دیده نمی شود؟

1)      قند ریبوز              2) باز آلی تیمین                      3) گروه فسفات                     4) اسیدآمینه

30-اگر درهنگام پروتئین سازی 20 کدون در جایگاه P وA (هردوجایگاه) قرار گرفته باشند، چندپیوند پپتیدی در ساختار پروتئین شکل می گیرد؟

   1)20                           2)21                                   3) 19                               4)18

31-آزمایشات نیرنبرگ کدام مطلب را آشکار ساخت؟

   1)مدل ملکولیDNA    2) رمز زنتیک           3) شناخت DNA بعنوان ماده وراثتی       4) ژنها برروی DNA استوار هستند

32- رونویسی ژن های مربوط به پروتئین های ریبوزومی توسط کدام آنزیم صورت می گیرد؟

   1) RNA پلیمرازپروکاریوتی        2) RNA پلیمرازI                    3) RNA پلیمرازII               4)  RNA پلیمرازIII  

 

33-رونویسی در کدام یک از موجودات زیر احتیاج به عوامل رونویسی ندارد؟

1)      استرپتوکوکوس نومونیا       2) مخمر                3) موجود مورد مطالعه بیدل وتاتوم    4) مگس سرکه

34-تفاوت در کار وشکل سلول های بدن نتیجه کدام است؟

   1)تنظیم بیان ژن              2) تعداد ملکول RNA             3) تعداد ژن                           4) ساختار وعمل

35- واحد سازنده کدام یک با بقیه متفاوت است؟

1)      کراتین                2) عامل تنظیمی اپران لک      3) عامل رونویسی از اپران لک         4)عامل تجزیه کننده اسیدهموجنتسیک

36-با توجه به طرح مقابل در رشته پلی پپتید حاصل اولین ودومین اسید آمینه چه خواهد بود؟

   1)فنیل آلانین-متیونین      2) فنیل آلانین- لیزین     3) لیزین- والین        4) لیزین- سیستئین

 

 

37-اگر دریک ملکول DNA  دررشته ای نسبت  برابر 10 باشد ، نسبت کل بازهای پورین به کل بازهای پیریمیدین چقدر است؟

1)      5                      2) 20                             3) 10                                     4) 1

38-دریک ملکول  RNAتعداد کدام موردالزاما ٌباهم برابر است؟

   1)A با U                    2)بازآلی باقندهای ریبوز         3) فسفات با پیوندهای فسفودی استر          4) بازآلی باپیوندهای هیدروژنی

39-درملکول RNA بااین ترتیب  (...........UCUCUCUCU )ساخته می شود.باتوجه به این که این ملکول درشرایط مناسب برای ساختن پروتئین درلوله آزمایش قرار گیرد، حکم صحیح را انتخاب کنید:

   1)دونوع زنجیره ی پلی پپتیدی ساخته می شود،که هرکدام دارای فقط یک اسیدآمینه است.

   2) دونوع زنجیره ی پلی پپتیدی ساخته می شود،که هرکدام دارای سه اسیدآمینه هستند.

   3) یک نوع زنجیره ی پلی پپتیدی ساخته می شود،که درآن دواسیدآمینه یکی درمیان قرار دارد.

   4) یک نوع زنجیره ی پلی پپتیدی ساخته می شود،که درآن سه اسیدامینه وجود دارد.

40-دررشته ی زیراگرترجمه ازسمت راست به چپ صورت گیرد، اولین رمزجایگاهA چیست؟ بعدازسه حرکت کدام رمز درجایگاهAقرار می گیرد؟

AUGCAAGAAUCCAGUACGGUAGCAAUG

   1)AGU - GCA             2) UGA – ACG                    3) AGU – CAA                    4) AAG – GCA



تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:26 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:16 | نویسنده : محمدحسن كاهي |
تاريخ : چهارشنبه سیزدهم آبان 1388 | 17:12 | نویسنده : محمدحسن كاهي |
156ـ از هيدروليز كامل كدام ، مونوساكاريد حاصل مي شود ؟
1) كوتين
2) كيتين
3) كراتين
4) لسيتين

ادامه مطلب
تاريخ : جمعه دهم مهر 1388 | 19:22 | نویسنده : محمدحسن كاهي |

1-شکل زیر بخشی از برش عرضی یک برگ معمولی مثل لوبیا را نشان می دهد. اگر لایه های مشخص شده در شکل را بر اساس مقدار کلروفیل شان مرتب کنیم ، کدام گزینه این ترتیب را به درستی نشان می دهد؟ 

 1)B>C > A=D

 2) B=C >A=D

  3) C > D>A B>

  4) B=C > D> A



ادامه مطلب
تاريخ : جمعه دهم مهر 1388 | 19:20 | نویسنده : محمدحسن كاهي |

1-ایستگاه شماره یک: شناسایی میکروسکوپ

نام ونقش بخش های مشخص شده درمیکروسکوپ را بنویسید:

الف)

ب)



ادامه مطلب
تاريخ : جمعه دهم مهر 1388 | 19:18 | نویسنده : محمدحسن كاهي |

1-     آزمایشی طراحی کنید که نشان دهد میکروب ها با ترشح آنزیم های خارج سلولی از مواد غذایی استفاده می کنند.(10 دقیقه)

    وسایل و مواد مورد نیاز : یک امتیاز

    شرح آزمایش : دو امتیاز

    نتیجه گیری : دو امتیاز



ادامه مطلب
تاريخ : جمعه دهم مهر 1388 | 19:0 | نویسنده : محمدحسن كاهي |
ایستگاه شماره ی 1 (تهیه مقطع گیاهی )

 

 


از نمونه گیاهی که در اختیار دارید مقطع عرضی تهیه کرده با رنگ مناسب رنگ آمیزی کنید که بتوان آوندهای آبکش  را مشاهده کرد. سپس نمونه آماده شده را زیر میکروسکوپ تنظیم نموده به داور آزمون ارائه نمائید. (10 دقیقه)

   تهیه برش نازک ومناسب : 1 امتیاز

  رنگ آمیزی صحیح و مناسب : 1 امتیاز

   تنظیم میکروسکوپ : 1 امتیاز

  رعایت زمان بندی :    1 امتیاز



ادامه مطلب
تاريخ : جمعه دهم مهر 1388 | 18:59 | نویسنده : محمدحسن كاهي |

1-      سنگدان کرم خاکی بین کدام بند های بدن واقع است؟

الف- 17-15                ب- 18-17                  ج- 12-10                       د- 15-13



ادامه مطلب
تاريخ : جمعه دهم مهر 1388 | 18:57 | نویسنده : محمدحسن كاهي |
تاريخ : جمعه دهم مهر 1388 | 18:51 | نویسنده : محمدحسن كاهي |
  • اس ام اس دون
  • بک لینک